| Sequence ID | Bclau.0 |
|---|---|
| Location | 57,623 – 57,643 |
| Length | 20 |
| Max. P | 0.866731 |
| Location | 57,623 – 57,643 |
|---|---|
| Length | 20 |
| Sequences | 3 |
| Columns | 20 |
| Reading direction | forward |
| Mean pairwise identity | 60.00 |
| Mean single sequence MFE | -1.97 |
| Consensus MFE | -3.11 |
| Energy contribution | -2.33 |
| Covariance contribution | -0.77 |
| Combinations/Pair | 1.60 |
| Mean z-score | 1.19 |
| Structure conservation index | 1.58 |
| SVM decision value | 0.85 |
| SVM RNA-class probability | 0.866731 |
| Prediction | RNA |
| WARNING | Structure conservation index out of range. |
| WARNING | Sequence 1 too short. |
| WARNING | Sequence 2 too short. |
| WARNING | Sequence 3 too short. |
Download alignment: ClustalW | MAF
>Bclau.0 57623 20 + 4303871 GCUUCGAAGAAGCAGAGUUA (((((...)))))....... ( -4.80) >Bhalo.0 662253 20 + 4202352 GAUCCGAAGGAGCAGAGUCA ..(((...)))......... ( -0.60) >Bsubt.0 171348 20 + 4214630 ACUUUGAAGAAGUGACAUUG (((((...)))))....... ( -0.50) >consensus GCUUCGAAGAAGCAGAGUUA (((((...)))))....... ( -3.11 = -2.33 + -0.77)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 17:20:41 2006