Sequence ID | Blich.0 |
---|---|
Location | 342,367 – 342,419 |
Length | 52 |
Max. P | 0.999308 |
Location | 342,367 – 342,419 |
---|---|
Length | 52 |
Sequences | 3 |
Columns | 52 |
Reading direction | forward |
Mean pairwise identity | 85.26 |
Mean single sequence MFE | -14.00 |
Consensus MFE | -12.90 |
Energy contribution | -12.23 |
Covariance contribution | -0.66 |
Combinations/Pair | 1.25 |
Mean z-score | -4.24 |
Structure conservation index | 0.92 |
SVM decision value | 2.15 |
SVM RNA-class probability | 0.989103 |
Prediction | RNA |
WARNING | Sequence 2: Base composition out of range. |
Download alignment: ClustalW | MAF
>Blich.0 342367 52 + 4222334 UUGAAAAAGUAUGUGAAGUAUUGCACAAUAUGAAUGUGAAGAAUUUCACAAA ...........((((((((....((((.......))))....)))))))).. ( -11.20) >Bclau.0 1301392 52 - 4303871 UUGAAAAUUUUUGUGAAAUAAUGCACAAUAUAAAUGUGAAUAAUUUCACAAA .........((((((((((.((.((((.......)))).)).)))))))))) ( -12.30) >Bsubt.0 329233 52 + 4214630 UUGCAAAAGUUUGUGAAGUGUUGCACAAUAUAAAUGUGAAAUACUUCACAAA .........(((((((((((((.((((.......)))).))))))))))))) ( -18.50) >consensus UUGAAAAAGUUUGUGAAGUAUUGCACAAUAUAAAUGUGAAAAAUUUCACAAA .........((((((((((.((.((((.......)))).)).)))))))))) (-12.90 = -12.23 + -0.66)
Location | 342,367 – 342,419 |
---|---|
Length | 52 |
Sequences | 3 |
Columns | 52 |
Reading direction | reverse |
Mean pairwise identity | 85.26 |
Mean single sequence MFE | -12.43 |
Consensus MFE | -11.97 |
Energy contribution | -12.53 |
Covariance contribution | 0.56 |
Combinations/Pair | 1.12 |
Mean z-score | -4.25 |
Structure conservation index | 0.96 |
SVM decision value | 2.30 |
SVM RNA-class probability | 0.991952 |
Prediction | RNA |
WARNING | Sequence 2: Base composition out of range. |
Download alignment: ClustalW | MAF
>Blich.0 342367 52 + 4222334 UUUGUGAAAUUCUUCACAUUCAUAUUGUGCAAUACUUCACAUACUUUUUCAA ..((((((......((((.......))))......))))))........... ( -8.20) >Bclau.0 1301392 52 - 4303871 UUUGUGAAAUUAUUCACAUUUAUAUUGUGCAUUAUUUCACAAAAAUUUUCAA ((((((((((.((.((((.......)))).)).))))))))))......... ( -13.60) >Bsubt.0 329233 52 + 4214630 UUUGUGAAGUAUUUCACAUUUAUAUUGUGCAACACUUCACAAACUUUUGCAA ((((((((((.((.((((.......)))).)).))))))))))......... ( -15.50) >consensus UUUGUGAAAUUAUUCACAUUUAUAUUGUGCAAUACUUCACAAACUUUUUCAA ((((((((((.((.((((.......)))).)).))))))))))......... (-11.97 = -12.53 + 0.56)
Location | 342,367 – 342,419 |
---|---|
Length | 52 |
Sequences | 2 |
Columns | 52 |
Reading direction | forward |
Mean pairwise identity | 86.54 |
Mean single sequence MFE | -14.85 |
Consensus MFE | -15.05 |
Energy contribution | -15.05 |
Covariance contribution | -0.00 |
Combinations/Pair | 1.13 |
Mean z-score | -4.87 |
Structure conservation index | 1.01 |
SVM decision value | 3.22 |
SVM RNA-class probability | 0.998772 |
Prediction | RNA |
Download alignment: ClustalW | MAF
>Blich.0 342367 52 + 4222334/0-52 UUGAAAAAGUAUGUGAAGUAUUGCACAAUAUGAAUGUGAAGAAUUUCACAAA ...........((((((((....((((.......))))....)))))))).. ( -11.20) >Bsubt.0 329233 52 + 4214630/0-52 UUGCAAAAGUUUGUGAAGUGUUGCACAAUAUAAAUGUGAAAUACUUCACAAA .........(((((((((((((.((((.......)))).))))))))))))) ( -18.50) >consensus UUGAAAAAGUAUGUGAAGUAUUGCACAAUAUAAAUGUGAAAAACUUCACAAA ...........(((((((((((.((((.......)))).))))))))))).. (-15.05 = -15.05 + -0.00)
Location | 342,367 – 342,419 |
---|---|
Length | 52 |
Sequences | 2 |
Columns | 52 |
Reading direction | reverse |
Mean pairwise identity | 86.54 |
Mean single sequence MFE | -11.85 |
Consensus MFE | -10.70 |
Energy contribution | -11.20 |
Covariance contribution | 0.50 |
Combinations/Pair | 1.00 |
Mean z-score | -4.56 |
Structure conservation index | 0.90 |
SVM decision value | 3.50 |
SVM RNA-class probability | 0.999308 |
Prediction | RNA |
Download alignment: ClustalW | MAF
>Blich.0 342367 52 + 4222334/0-52 UUUGUGAAAUUCUUCACAUUCAUAUUGUGCAAUACUUCACAUACUUUUUCAA ..((((((......((((.......))))......))))))........... ( -8.20) >Bsubt.0 329233 52 + 4214630/0-52 UUUGUGAAGUAUUUCACAUUUAUAUUGUGCAACACUUCACAAACUUUUGCAA ((((((((((.((.((((.......)))).)).))))))))))......... ( -15.50) >consensus UUUGUGAAAUACUUCACAUUCAUAUUGUGCAACACUUCACAAACUUUUGCAA ..((((((((....((((.......))))....))))))))........... (-10.70 = -11.20 + 0.50)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 17:20:43 2006