| Sequence ID | Bsubt.0 |
|---|---|
| Location | 1,539,007 – 1,539,099 |
| Length | 92 |
| Max. P | 0.999731 |
| Location | 1,539,007 – 1,539,099 |
|---|---|
| Length | 92 |
| Sequences | 5 |
| Columns | 92 |
| Reading direction | forward |
| Mean pairwise identity | 83.37 |
| Mean single sequence MFE | -19.16 |
| Consensus MFE | -16.38 |
| Energy contribution | -15.98 |
| Covariance contribution | -0.40 |
| Combinations/Pair | 1.11 |
| Mean z-score | -3.05 |
| Structure conservation index | 0.85 |
| SVM decision value | 3.05 |
| SVM RNA-class probability | 0.998272 |
| Prediction | RNA |
| WARNING | Sequence 1: Base composition out of range. |
Download alignment: ClustalW | MAF
>Bsubt.0 1539007 92 + 4214630 AAAAAUAAGAUUCCCCUGGCCAGGAGAAUCUUAUUAUACAUACAAAUAUAUUAAUAGUAAAUUUUAGCAUAAAUAAAUUUUUUUGUCAAUGU ...((((((((((.(((....))).))))))))))...............................((((..(((((....)))))..)))) ( -17.20) >Bclau.0 3343943 90 + 4303871 AAAAAUAGGAUUCCCCUGGCCAGGAGAAUCCCAUUAUACA-ACAAAAACAAUAAUAUUUAAUUCUAGCAUAAACAAAUUUUUUUGUCAA-GU ...(((.((((((.(((....))).)))))).))).....-...............................(((((....)))))...-.. ( -13.70) >Blich.0 3140512 92 + 4222334 AAAAAUAGGAUUCUCCCGGCCAGGAGAAUCCUAUUAUACACACCAAUAUUUAAUUAUUAAAUUAUAGCAUAAAUAAAUUUUUUUGUCAAGAA ...(((((((((((((......)))))))))))))...........((((((.((((......))))..))))))................. ( -20.30) >Banth.0 2993589 92 + 5227293 AAAAAUAGGGUUCCCCUGGCCAGGAGAACCCUAUUAUACACUUUAUUUUUAUAUUGGUAAAUUAUAGCAUAAAUAAGUUUUUUUGUCAAGUU ...((((((((((.(((....))).))))))))))..................(((..(((....(((........)))..)))..)))... ( -22.30) >Bcere.0 3055128 92 + 5224283 AAAAAUAGGGUUCCCCUGGCCAGGAGAACCCUAUUAUACACUUUAUUUUUAUAUUGGUAAAUUAUAGCAUAAAUAAGUUUUUUUGUCAAGUU ...((((((((((.(((....))).))))))))))..................(((..(((....(((........)))..)))..)))... ( -22.30) >consensus AAAAAUAGGAUUCCCCUGGCCAGGAGAAUCCUAUUAUACACACAAAUAUUAUAUUAGUAAAUUAUAGCAUAAAUAAAUUUUUUUGUCAAGGU ...((((((((((.(((....))).))))))))))...............................(((.(((......))).)))...... (-16.38 = -15.98 + -0.40)
| Location | 1,539,007 – 1,539,099 |
|---|---|
| Length | 92 |
| Sequences | 5 |
| Columns | 92 |
| Reading direction | reverse |
| Mean pairwise identity | 83.37 |
| Mean single sequence MFE | -23.44 |
| Consensus MFE | -21.75 |
| Energy contribution | -20.47 |
| Covariance contribution | -1.28 |
| Combinations/Pair | 1.28 |
| Mean z-score | -3.91 |
| Structure conservation index | 0.93 |
| SVM decision value | 3.96 |
| SVM RNA-class probability | 0.999731 |
| Prediction | RNA |
| WARNING | Sequence 1: Base composition out of range. |
Download alignment: ClustalW | MAF
>Bsubt.0 1539007 92 + 4214630 ACAUUGACAAAAAAAUUUAUUUAUGCUAAAAUUUACUAUUAAUAUAUUUGUAUGUAUAAUAAGAUUCUCCUGGCCAGGGGAAUCUUAUUUUU ......(((...((((.((((.(((.((.....)).))).)))).))))...)))..((((((((((((((....))))))))))))))... ( -19.40) >Bclau.0 3343943 90 + 4303871 AC-UUGACAAAAAAAUUUGUUUAUGCUAGAAUUAAAUAUUAUUGUUUUUGU-UGUAUAAUGGGAUUCUCCUGGCCAGGGGAAUCCUAUUUUU ..-..((((((((....((((((.........))))))......)))))))-)....((((((((((((((....))))))))))))))... ( -26.30) >Blich.0 3140512 92 + 4222334 UUCUUGACAAAAAAAUUUAUUUAUGCUAUAAUUUAAUAAUUAAAUAUUGGUGUGUAUAAUAGGAUUCUCCUGGCCGGGAGAAUCCUAUUUUU ......(((..((.(((((.((((...........)))).))))).))..)))....((((((((((((((....))))))))))))))... ( -25.50) >Banth.0 2993589 92 + 5227293 AACUUGACAAAAAAACUUAUUUAUGCUAUAAUUUACCAAUAUAAAAAUAAAGUGUAUAAUAGGGUUCUCCUGGCCAGGGGAACCCUAUUUUU .....................((((((.((.(((.........))).)).)))))).((((((((((((((....))))))))))))))... ( -23.00) >Bcere.0 3055128 92 + 5224283 AACUUGACAAAAAAACUUAUUUAUGCUAUAAUUUACCAAUAUAAAAAUAAAGUGUAUAAUAGGGUUCUCCUGGCCAGGGGAACCCUAUUUUU .....................((((((.((.(((.........))).)).)))))).((((((((((((((....))))))))))))))... ( -23.00) >consensus AACUUGACAAAAAAAUUUAUUUAUGCUAUAAUUUACUAAUAUAAUAUUAGUGUGUAUAAUAGGAUUCUCCUGGCCAGGGGAAUCCUAUUUUU ....................((((((...........................))))))((((((((((((....))))))))))))..... (-21.75 = -20.47 + -1.28)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 17:19:37 2006