| Sequence ID | Bhalo.0 |
|---|---|
| Location | 3,362,956 – 3,363,009 |
| Length | 53 |
| Max. P | 0.603295 |
| Location | 3,362,956 – 3,363,009 |
|---|---|
| Length | 53 |
| Sequences | 4 |
| Columns | 54 |
| Reading direction | forward |
| Mean pairwise identity | 76.95 |
| Mean single sequence MFE | -7.25 |
| Consensus MFE | -5.72 |
| Energy contribution | -6.22 |
| Covariance contribution | 0.50 |
| Combinations/Pair | 1.15 |
| Mean z-score | -1.35 |
| Structure conservation index | 0.79 |
| SVM decision value | 0.14 |
| SVM RNA-class probability | 0.603295 |
| Prediction | RNA |
| WARNING | Sequence 4: Base composition out of range. |
Download alignment: ClustalW | MAF
>Bhalo.0 3362956 53 + 4202352 CAAAUGUCACGAACUUUUU-CUUUAUUAAUUAGACGCUUUUAAGUACUAAAGUA ...................-(((((.((.(((((....))))).)).))))).. ( -2.50) >Bclau.0 2901319 53 + 4303871 AAAAAGUCACGGACUUUUU-CUUUAUUACUUAGACGCUUUUACGUAAUAAAGUG ((((((((...))))))))-(((((((((.((((....)))).))))))))).. ( -12.30) >Blich.0 3009571 53 + 4222334 AAAAUGUCACGAAAAAAUU-CUUUAUUACCCAAACGCUUUUAAGUGAUAAAGCA ...................-(((((((((..(((....)))..))))))))).. ( -5.80) >Bsubt.0 3045655 54 + 4214630 AAAAUUUUAUAAAAACUCUACUUUAUUACCCAAACGCUUUUAAGUGAUAAAGUA ..................(((((((((((..(((....)))..))))))))))) ( -8.40) >consensus AAAAUGUCACGAAAAUUUU_CUUUAUUACCCAAACGCUUUUAAGUAAUAAAGUA ....................(((((((((.((((....)))).))))))))).. ( -5.72 = -6.22 + 0.50)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 17:18:32 2006