| Sequence ID | Blich.0 |
|---|---|
| Location | 2,686,620 – 2,686,686 |
| Length | 66 |
| Max. P | 0.872395 |
| Location | 2,686,620 – 2,686,686 |
|---|---|
| Length | 66 |
| Sequences | 3 |
| Columns | 66 |
| Reading direction | forward |
| Mean pairwise identity | 74.75 |
| Mean single sequence MFE | -26.57 |
| Consensus MFE | -21.73 |
| Energy contribution | -20.63 |
| Covariance contribution | -1.10 |
| Combinations/Pair | 1.30 |
| Mean z-score | -8.09 |
| Structure conservation index | 0.82 |
| SVM decision value | 0.88 |
| SVM RNA-class probability | 0.872395 |
| Prediction | RNA |
| WARNING | Mean z-score out of range. |
| WARNING | Sequence 1: Base composition out of range. |
Download alignment: ClustalW | MAF
>Blich.0 2686620 66 + 4222334 AACAAGAACUAAAGGAGUUAUACAUAUUAGUCAUGUAAAAUAUAUAUAACUCCUUAUUUUUUAUGA ...........(((((((((((.(((((..........))))).)))))))))))........... ( -14.80) >Bsubt.0 3664897 66 - 4214630 AACAAGAAAGAAAAGGGUGAUACAUAUUAAUCAUGUAUAAUAUGUAUCACCCUUUAGUUUUUUUGA ..((((((((.((((((((((((((((((........))))))))))))))))))..)))))))). ( -30.10) >Bcere.0 2950503 65 + 5224283 AAUGAGAGAUAAAAGA-UGAUACAUGUUAGUCAUGACUAACAUGUAUCAUCUUUUAAUUUUCGUGA .(((((((.(((((((-((((((((((((((....))))))))))))))))))))).))))))).. ( -34.80) >consensus AACAAGAAAUAAAAGAGUGAUACAUAUUAGUCAUGUAUAAUAUGUAUCACCCUUUAAUUUUUAUGA ...(((((...((((((((((((((((((........))))))))))))))))))..))))).... (-21.73 = -20.63 + -1.10)
| Location | 2,686,620 – 2,686,686 |
|---|---|
| Length | 66 |
| Sequences | 3 |
| Columns | 66 |
| Reading direction | reverse |
| Mean pairwise identity | 74.75 |
| Mean single sequence MFE | -24.93 |
| Consensus MFE | -20.83 |
| Energy contribution | -19.83 |
| Covariance contribution | -0.99 |
| Combinations/Pair | 1.33 |
| Mean z-score | -8.23 |
| Structure conservation index | 0.84 |
| SVM decision value | 0.86 |
| SVM RNA-class probability | 0.869660 |
| Prediction | RNA |
| WARNING | Mean z-score out of range. |
| WARNING | Sequence 1: Base composition out of range. |
Download alignment: ClustalW | MAF
>Blich.0 2686620 66 + 4222334 UCAUAAAAAAUAAGGAGUUAUAUAUAUUUUACAUGACUAAUAUGUAUAACUCCUUUAGUUCUUGUU ..((((.((..(((((((((((((((((..........)))))))))))))))))...)).)))). ( -19.20) >Bsubt.0 3664897 66 - 4214630 UCAAAAAAACUAAAGGGUGAUACAUAUUAUACAUGAUUAAUAUGUAUCACCCUUUUCUUUCUUGUU .(((.(((...((((((((((((((((((........))))))))))))))))))..))).))).. ( -25.90) >Bcere.0 2950503 65 + 5224283 UCACGAAAAUUAAAAGAUGAUACAUGUUAGUCAUGACUAACAUGUAUCA-UCUUUUAUCUCUCAUU ....((....(((((((((((((((((((((....))))))))))))))-)))))))....))... ( -29.70) >consensus UCAAAAAAAAUAAAGGGUGAUACAUAUUAUACAUGACUAAUAUGUAUCACUCUUUUAUUUCUUGUU ...........((((((((((((((((((........))))))))))))))))))........... (-20.83 = -19.83 + -0.99)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 17:25:16 2006