| Sequence ID | sy_sa.0 |
|---|---|
| Location | 2,076,167 – 2,076,215 |
| Length | 48 |
| Max. P | 0.741449 |
| Location | 2,076,167 – 2,076,215 |
|---|---|
| Length | 48 |
| Sequences | 3 |
| Columns | 50 |
| Reading direction | forward |
| Mean pairwise identity | 70.27 |
| Mean single sequence MFE | -13.77 |
| Consensus MFE | -4.57 |
| Energy contribution | -4.80 |
| Covariance contribution | 0.23 |
| Combinations/Pair | 1.40 |
| Mean z-score | -4.61 |
| Structure conservation index | 0.33 |
| SVM decision value | 0.45 |
| SVM RNA-class probability | 0.741449 |
| Prediction | RNA |
| WARNING | Sequence 2: Base composition out of range. |
Download alignment: ClustalW | MAF
>sy_sa.0 2076167 48 + 2516575 CAUGUA-CAACGUC-UGUCUUUUUUAUAGAGAUAGGCGUUUUUUUAUGCG ((((..-.((((((-(((((((.....)))))))))))))....)))).. ( -16.80) >sy_ha.0 2221336 48 + 2685015 AAUGUUUCUAAGUC-UAUCUUUUUUAUAGAGAUAGAC-UUUUUUUAUGUU (((((....(((((-(((((((.....))))))))))-)).....))))) ( -13.70) >sy_au.0 2015809 49 - 2809422 AACCCAUUUCUUUCGUCUAUCUUUUAUGGAGAUAGGC-UUUUUUUAUUUU ..............(((((((((.....)))))))))-............ ( -10.80) >consensus AAUGUAUCUAAGUC_UAUCUUUUUUAUAGAGAUAGGC_UUUUUUUAUGUU ...........(((.(((((((.....))))))))))............. ( -4.57 = -4.80 + 0.23)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 18:55:42 2006