| Sequence ID | sy_ha.0 |
|---|---|
| Location | 1,903,274 – 1,903,361 |
| Length | 87 |
| Max. P | 0.999873 |

| Location | 1,903,274 – 1,903,361 |
|---|---|
| Length | 87 |
| Sequences | 3 |
| Columns | 89 |
| Reading direction | forward |
| Mean pairwise identity | 76.98 |
| Mean single sequence MFE | -19.36 |
| Consensus MFE | -12.49 |
| Energy contribution | -14.83 |
| Covariance contribution | 2.34 |
| Combinations/Pair | 1.15 |
| Mean z-score | -4.03 |
| Structure conservation index | 0.65 |
| SVM decision value | 4.33 |
| SVM RNA-class probability | 0.999873 |
| Prediction | RNA |
| WARNING | Sequence 1: Base composition out of range. |
| WARNING | Sequence 2: Base composition out of range. |
| WARNING | Sequence 3: Base composition out of range. |
Download alignment: ClustalW | MAF
>sy_ha.0 1903274 87 + 2685015 UUAAAAAA--GCUAUACUUUGUUUAGUAAUAUUAAACAUUUUGUUUAAUGCUUAAUAAAAGUAACAAAAUAUAGCUUUAACUUCAAUAC .....(((--((((((.((((((......((((((.((((......)))).)))))).....)))))).)))))))))........... ( -19.00) >sy_au.0 1691892 87 - 2809422 CUAAAAAA--GCUAUAUUAAGUUUACUUUUAUCAAACAUUUUGUUUAACACUUGAUAAAGGUAUCAAAAUAUAGCUUUAUUAGCAAUAG ((((.(((--((((((((.....((((((((((((................))))))))))))....))))))))))).))))...... ( -23.79) >sy_sa.0 1759661 89 + 2516575 UUAAAAAAUCGUUAUAUGCUGUUUAUAUUUAUCAAACAUUUUGUUUAAUGCUUAAUAAAAAUAUCAAAAUAUAACGAUGAAGACAAUAC .......((((((((((..((..(((.(((((.((.((((......)))).)).))))).))).))..))))))))))........... ( -15.30) >consensus UUAAAAAA__GCUAUAUUAUGUUUACUUUUAUCAAACAUUUUGUUUAAUGCUUAAUAAAAGUAUCAAAAUAUAGCUUUAAAAACAAUAC ..........((((((((.((..((((((((((((.((((......)))).)))))))))))).)).)))))))).............. (-12.49 = -14.83 + 2.34)



| Location | 1,903,274 – 1,903,361 |
|---|---|
| Length | 87 |
| Sequences | 3 |
| Columns | 89 |
| Reading direction | reverse |
| Mean pairwise identity | 76.98 |
| Mean single sequence MFE | -24.43 |
| Consensus MFE | -18.04 |
| Energy contribution | -18.17 |
| Covariance contribution | 0.12 |
| Combinations/Pair | 1.30 |
| Mean z-score | -5.13 |
| Structure conservation index | 0.74 |
| SVM decision value | 3.62 |
| SVM RNA-class probability | 0.999457 |
| Prediction | RNA |
| WARNING | Sequence 1: Base composition out of range. |
| WARNING | Sequence 2: Base composition out of range. |
| WARNING | Sequence 3: Base composition out of range. |
Download alignment: ClustalW | MAF
>sy_ha.0 1903274 87 + 2685015 GUAUUGAAGUUAAAGCUAUAUUUUGUUACUUUUAUUAAGCAUUAAACAAAAUGUUUAAUAUUACUAAACAAAGUAUAGC--UUUUUUAA ...........((((((((((((((((.....(((((((((((......)))))))))))......)))))))))))))--)))..... ( -25.90) >sy_au.0 1691892 87 - 2809422 CUAUUGCUAAUAAAGCUAUAUUUUGAUACCUUUAUCAAGUGUUAAACAAAAUGUUUGAUAAAAGUAAACUUAAUAUAGC--UUUUUUAG ......((((.(((((((((((..(.(((.(((((((((..((......))..))))))))).)))..)..))))))))--))).)))) ( -25.30) >sy_sa.0 1759661 89 + 2516575 GUAUUGUCUUCAUCGUUAUAUUUUGAUAUUUUUAUUAAGCAUUAAACAAAAUGUUUGAUAAAUAUAAACAGCAUAUAACGAUUUUUUAA ...........((((((((((.(((.(((.(((((((((((((......))))))))))))).)))..))).))))))))))....... ( -22.10) >consensus GUAUUGAAAUUAAAGCUAUAUUUUGAUACUUUUAUUAAGCAUUAAACAAAAUGUUUGAUAAAAAUAAACAAAAUAUAGC__UUUUUUAA ..............(((((((((((.(((.(((((((((((((......))))))))))))).)))..))))))))))).......... (-18.04 = -18.17 + 0.12) # Strand winner: reverse (1.00)



Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 18:54:28 2006