Sequence ID | sp_mu.0 |
---|---|
Location | 1,975,645 – 1,975,729 |
Length | 84 |
Max. P | 0.996610 |
Location | 1,975,645 – 1,975,729 |
---|---|
Length | 84 |
Sequences | 3 |
Columns | 89 |
Reading direction | forward |
Mean pairwise identity | 71.32 |
Mean single sequence MFE | -15.13 |
Consensus MFE | -9.27 |
Energy contribution | -10.17 |
Covariance contribution | 0.89 |
Combinations/Pair | 1.20 |
Mean z-score | -2.08 |
Structure conservation index | 0.61 |
SVM decision value | 2.72 |
SVM RNA-class probability | 0.996610 |
Prediction | RNA |
WARNING | Sequence 3: Base composition out of range. |
Download alignment: ClustalW | MAF
>sp_mu.0 1975645 84 + 2030921 AUCUGUCAAGUAACUUUACUUUACAAGAAUCUUUUGAUAUACUAUUAAAGUUGACGCAAGUCA-----UAUUAACCCAAAAAAUGAAUA .(((((.(((((....))))).)).)))...((((((((...)))))))).((((....))))-----..................... ( -12.80) >sp_ag.0 2090743 89 + 2160267 UUUUGUCAAGUAACUUUACUUUACAAAAAAGAUAUGUUAUCAUAGUGAAGUUGAUGAAAAUCAAAACUUACACAUCGAAAGGAAGAAUA ((((((.(((((....))))).))))))....((((....))))(((((((((((....))))..)))).))).((....))....... ( -18.60) >sp_pn.0 1924851 86 + 2038615 UUUUGUCAAGUAACUUUACUUUACAAAAAAAAUGUGUUAUCCUAGUAUGGUUGAUGAAAAUCAGUA--GAUUGAAUCGAAU-AUAAAUA ((((((.(((((....))))).)))))).................((((.(((((...((((....--))))..))))).)-))).... ( -14.00) >consensus UUUUGUCAAGUAACUUUACUUUACAAAAAAAAUAUGUUAUCCUAGUAAAGUUGAUGAAAAUCA__A__UAUUAAACCAAAA_AUGAAUA .(((((.(((((....))))).))))).......................(((((....)))))......................... ( -9.27 = -10.17 + 0.89)
Location | 1,975,645 – 1,975,729 |
---|---|
Length | 84 |
Sequences | 2 |
Columns | 89 |
Reading direction | forward |
Mean pairwise identity | 68.54 |
Mean single sequence MFE | -15.70 |
Consensus MFE | -9.45 |
Energy contribution | -9.95 |
Covariance contribution | 0.50 |
Combinations/Pair | 1.14 |
Mean z-score | -2.55 |
Structure conservation index | 0.60 |
SVM decision value | 2.04 |
SVM RNA-class probability | 0.986490 |
Prediction | RNA |
Download alignment: ClustalW | MAF
>sp_mu.0 1975645 84 + 2030921/0-89 AUCUGUCAAGUAACUUUACUUUACAAGAAUCUUUUGAUAUACUAUUAAAGUUGACGCAAGUCA-----UAUUAACCCAAAAAAUGAAUA .(((((.(((((....))))).)).)))...((((((((...)))))))).((((....))))-----..................... ( -12.80) >sp_ag.0 2090743 89 + 2160267/0-89 UUUUGUCAAGUAACUUUACUUUACAAAAAAGAUAUGUUAUCAUAGUGAAGUUGAUGAAAAUCAAAACUUACACAUCGAAAGGAAGAAUA ((((((.(((((....))))).))))))....((((....))))(((((((((((....))))..)))).))).((....))....... ( -18.60) >consensus AUCUGUCAAGUAACUUUACUUUACAAAAAACAUAUGAUAUAAUAGUAAAGUUGACGAAAAUCA_____UACAAACCCAAAAAAAGAAUA .(((((.(((((....))))).)))))........................((((....)))).......................... ( -9.45 = -9.95 + 0.50)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 18:51:17 2006