| Sequence ID | sp_mu.0 |
|---|---|
| Location | 1,975,645 – 1,975,729 |
| Length | 84 |
| Max. P | 0.996610 |

| Location | 1,975,645 – 1,975,729 |
|---|---|
| Length | 84 |
| Sequences | 3 |
| Columns | 89 |
| Reading direction | forward |
| Mean pairwise identity | 71.32 |
| Mean single sequence MFE | -15.13 |
| Consensus MFE | -9.27 |
| Energy contribution | -10.17 |
| Covariance contribution | 0.89 |
| Combinations/Pair | 1.20 |
| Mean z-score | -2.08 |
| Structure conservation index | 0.61 |
| SVM decision value | 2.72 |
| SVM RNA-class probability | 0.996610 |
| Prediction | RNA |
| WARNING | Sequence 3: Base composition out of range. |
Download alignment: ClustalW | MAF
>sp_mu.0 1975645 84 + 2030921 AUCUGUCAAGUAACUUUACUUUACAAGAAUCUUUUGAUAUACUAUUAAAGUUGACGCAAGUCA-----UAUUAACCCAAAAAAUGAAUA .(((((.(((((....))))).)).)))...((((((((...)))))))).((((....))))-----..................... ( -12.80) >sp_ag.0 2090743 89 + 2160267 UUUUGUCAAGUAACUUUACUUUACAAAAAAGAUAUGUUAUCAUAGUGAAGUUGAUGAAAAUCAAAACUUACACAUCGAAAGGAAGAAUA ((((((.(((((....))))).))))))....((((....))))(((((((((((....))))..)))).))).((....))....... ( -18.60) >sp_pn.0 1924851 86 + 2038615 UUUUGUCAAGUAACUUUACUUUACAAAAAAAAUGUGUUAUCCUAGUAUGGUUGAUGAAAAUCAGUA--GAUUGAAUCGAAU-AUAAAUA ((((((.(((((....))))).)))))).................((((.(((((...((((....--))))..))))).)-))).... ( -14.00) >consensus UUUUGUCAAGUAACUUUACUUUACAAAAAAAAUAUGUUAUCCUAGUAAAGUUGAUGAAAAUCA__A__UAUUAAACCAAAA_AUGAAUA .(((((.(((((....))))).))))).......................(((((....)))))......................... ( -9.27 = -10.17 + 0.89)



| Location | 1,975,645 – 1,975,729 |
|---|---|
| Length | 84 |
| Sequences | 2 |
| Columns | 89 |
| Reading direction | forward |
| Mean pairwise identity | 68.54 |
| Mean single sequence MFE | -15.70 |
| Consensus MFE | -9.45 |
| Energy contribution | -9.95 |
| Covariance contribution | 0.50 |
| Combinations/Pair | 1.14 |
| Mean z-score | -2.55 |
| Structure conservation index | 0.60 |
| SVM decision value | 2.04 |
| SVM RNA-class probability | 0.986490 |
| Prediction | RNA |
Download alignment: ClustalW | MAF
>sp_mu.0 1975645 84 + 2030921/0-89 AUCUGUCAAGUAACUUUACUUUACAAGAAUCUUUUGAUAUACUAUUAAAGUUGACGCAAGUCA-----UAUUAACCCAAAAAAUGAAUA .(((((.(((((....))))).)).)))...((((((((...)))))))).((((....))))-----..................... ( -12.80) >sp_ag.0 2090743 89 + 2160267/0-89 UUUUGUCAAGUAACUUUACUUUACAAAAAAGAUAUGUUAUCAUAGUGAAGUUGAUGAAAAUCAAAACUUACACAUCGAAAGGAAGAAUA ((((((.(((((....))))).))))))....((((....))))(((((((((((....))))..)))).))).((....))....... ( -18.60) >consensus AUCUGUCAAGUAACUUUACUUUACAAAAAACAUAUGAUAUAAUAGUAAAGUUGACGAAAAUCA_____UACAAACCCAAAAAAAGAAUA .(((((.(((((....))))).)))))........................((((....)))).......................... ( -9.45 = -9.95 + 0.50)



Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 18:51:17 2006