Sequence ID | sy_ha.0 |
---|---|
Location | 1,168,417 – 1,168,514 |
Length | 97 |
Max. P | 0.969743 |
Location | 1,168,417 – 1,168,514 |
---|---|
Length | 97 |
Sequences | 3 |
Columns | 100 |
Reading direction | forward |
Mean pairwise identity | 74.50 |
Mean single sequence MFE | -17.58 |
Consensus MFE | -12.35 |
Energy contribution | -13.47 |
Covariance contribution | 1.12 |
Combinations/Pair | 1.14 |
Mean z-score | -1.74 |
Structure conservation index | 0.70 |
SVM decision value | 1.65 |
SVM RNA-class probability | 0.969743 |
Prediction | RNA |
WARNING | Sequence 1: Base composition out of range. |
WARNING | Sequence 2: Base composition out of range. |
WARNING | Sequence 3: Base composition out of range. |
Download alignment: ClustalW | MAF
>sy_ha.0 1168417 97 + 2685015 CAUUUUCCUUUCUAUCUAACUU-AGUUCUAAGUAAAGAUUUUAACAUACUUUAAUGUUAUAGUGUUUAAUGUAGUUCAACAAAAAU--AUAAAGAGGGGA .....((((((((.....((((-(....)))))(((.(((.((((((......)))))).))).)))...................--....)))))))) ( -17.40) >sy_au.0 942615 95 - 2809422 CAUUUUCCUUUCUAUAAAAAAAGAGUUCUAAGUACAGAUUUUAACAUAUUUUAAUGUUAUAGUGUUUAUUAUAGUUUGACAAAAA-----AGAGAGAGGA .....((((((((..............(((((((.(.(((.((((((......)))))).))).).)))).)))...........-----..)))))))) ( -16.63) >sy_sa.0 1035066 95 + 2516575 CAUUUUCCUUUCU-----AAAUUCAUUCUAGUUAAAGAUUUUAACAUAUUUUAAUGAUAUAGUGUUUAAAGUAAAAUAAGAAAUUUUGAUGUAGAAAGGA .....((((((((-----(...(((((((.(((((.....))))).((((((((...........)))))))).....))))....)))..))))))))) ( -18.70) >consensus CAUUUUCCUUUCUAU__AAAAU_AGUUCUAAGUAAAGAUUUUAACAUAUUUUAAUGUUAUAGUGUUUAAUGUAGUUUAACAAAAAU__AUAAAGAGAGGA .....((((((((...........((((((((((((.(((.((((((......)))))).))).)))))).)))...)))............)))))))) (-12.35 = -13.47 + 1.12)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 18:52:59 2006