Sequence ID | sy_sa.0 |
---|---|
Location | 662,212 – 662,266 |
Length | 54 |
Max. P | 0.936756 |
Location | 662,212 – 662,266 |
---|---|
Length | 54 |
Sequences | 3 |
Columns | 55 |
Reading direction | forward |
Mean pairwise identity | 86.67 |
Mean single sequence MFE | -23.37 |
Consensus MFE | -22.87 |
Energy contribution | -22.77 |
Covariance contribution | -0.11 |
Combinations/Pair | 1.16 |
Mean z-score | -7.92 |
Structure conservation index | 0.98 |
SVM decision value | 1.26 |
SVM RNA-class probability | 0.936756 |
Prediction | RNA |
WARNING | Mean z-score out of range. |
WARNING | Sequence 1: Base composition out of range. |
Download alignment: ClustalW | MAF
>sy_sa.0 662212 54 + 2516575 AGAUUAGCUAUGAAGAAAUCUUU-ACAAUAGAUUUUUUCAUAGCUAUUUUUUAUA ....(((((((((((((((((..-.....)))))))))))))))))......... ( -21.20) >sy_au.0 1932251 55 - 2809422 AGAUUAGCUAUGAAGGAAUCUAUGACGAUAGAUUUUUUCAUAGCUAUUUUUUAUA ....(((((((((((((((((((....)))))))))))))))))))......... ( -23.40) >sy_ha.0 936368 55 - 2685015 AAAAUAGCUAUGAAGUAAUCUAUGACUAUAGAAUGCUUCAUAGCUAUUUUUCAUA (((((((((((((((((.(((((....))))).)))))))))))))))))..... ( -25.50) >consensus AGAUUAGCUAUGAAGAAAUCUAUGACAAUAGAUUUUUUCAUAGCUAUUUUUUAUA ....(((((((((((((((((((....)))))))))))))))))))......... (-22.87 = -22.77 + -0.11)
Location | 662,212 – 662,266 |
---|---|
Length | 54 |
Sequences | 3 |
Columns | 55 |
Reading direction | reverse |
Mean pairwise identity | 86.67 |
Mean single sequence MFE | -19.37 |
Consensus MFE | -16.47 |
Energy contribution | -17.13 |
Covariance contribution | 0.67 |
Combinations/Pair | 1.00 |
Mean z-score | -7.00 |
Structure conservation index | 0.85 |
SVM decision value | 0.89 |
SVM RNA-class probability | 0.874550 |
Prediction | RNA |
WARNING | Sequence 1: Base composition out of range. |
Download alignment: ClustalW | MAF
>sy_sa.0 662212 54 + 2516575 UAUAAAAAAUAGCUAUGAAAAAAUCUAUUGU-AAAGAUUUCUUCAUAGCUAAUCU .........((((((((((.((((((.....-..)))))).)))))))))).... ( -17.60) >sy_au.0 1932251 55 - 2809422 UAUAAAAAAUAGCUAUGAAAAAAUCUAUCGUCAUAGAUUCCUUCAUAGCUAAUCU .........((((((((((..(((((((....)))))))..)))))))))).... ( -18.50) >sy_ha.0 936368 55 - 2685015 UAUGAAAAAUAGCUAUGAAGCAUUCUAUAGUCAUAGAUUACUUCAUAGCUAUUUU .....(((((((((((((((...(((((....)))))...))))))))))))))) ( -22.00) >consensus UAUAAAAAAUAGCUAUGAAAAAAUCUAUAGUCAUAGAUUACUUCAUAGCUAAUCU .........((((((((((..(((((((....)))))))..)))))))))).... (-16.47 = -17.13 + 0.67) # Strand winner: forward (0.99)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 18:51:57 2006