Sequence ID | sy_sa.0 |
---|---|
Location | 222,798 – 222,862 |
Length | 64 |
Max. P | 0.993214 |
Location | 222,798 – 222,862 |
---|---|
Length | 64 |
Sequences | 3 |
Columns | 64 |
Reading direction | reverse |
Mean pairwise identity | 87.43 |
Mean single sequence MFE | -11.30 |
Consensus MFE | -10.85 |
Energy contribution | -10.63 |
Covariance contribution | -0.22 |
Combinations/Pair | 1.07 |
Mean z-score | -2.75 |
Structure conservation index | 0.96 |
SVM decision value | 2.38 |
SVM RNA-class probability | 0.993214 |
Prediction | RNA |
WARNING | Sequence 1: Base composition out of range. |
WARNING | Sequence 2: Base composition out of range. |
WARNING | Sequence 3: Base composition out of range. |
Download alignment: ClustalW | MAF
>sy_sa.0 222798 64 + 2516575 AAUUACCUCCGUUAAGUUUGUUAAAUUUUUAUUUAACGAAUUUUAUAGAUUUUAUGUUACCAUA .......((..(.(((((((((((((....))))))))))))).)..))............... ( -10.30) >sy_au.0 119904 63 - 2809422 AACAACCUCCGUUAAGUUUGUUAAAUUUUUAUUUAACGAAUUUUACAAA-CUUAUGUUAGCAUA ..........((.(((((((((((((....))))))))))))).))...-..((((....)))) ( -12.20) >sy_ha.0 445243 63 + 2685015 AACUACCUCCGUUAAGUUUGUUAAAUUUUUAUUUAACGAAUUUUACAAA-ACUAGAUUAUCACA ..........((.(((((((((((((....))))))))))))).))...-.............. ( -11.40) >consensus AACUACCUCCGUUAAGUUUGUUAAAUUUUUAUUUAACGAAUUUUACAAA_AUUAUGUUACCAUA ..........((.(((((((((((((....))))))))))))).)).................. (-10.85 = -10.63 + -0.22) # Strand winner: reverse (0.99)
Generated by rnazCluster.pl (part of RNAz $RNAz::rnazVersion) on Thu Apr 6 18:51:45 2006